Quick Taq™ HS DyeMix
Taq DNA Polymerase Master Mix (Hot Start)
Quick Taq™ HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.
Features
-
Direct gel loading PCR products can be applied directly to agarose or acrylamide gels without adding loading dye.
-
Improved performance vs. conventional Taq Provides higher yield and stronger amplification efficiency than standard Taq DNA polymerase.
-
Hot‑start PCR for high specificity and sensitivity Antibody‑mediated hot start reduces nonspecific amplification and improves detection of low‑copy targets.
-
Excellent stability Stable for at least 3 months at 4°C. Maintains performance even after 30 freeze–thaw cycles with no detectable loss of activity
Application Data
1) Amplification of the human p53 genes (2.9 kb)
The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA.
Quick Taq™ HS DyeMix successfully amplified the targets
 |
M: 1 kb Ladder Template: Human genomic DNA 50 ng / 50 µL reaction |
2) Insert amplification by a colony-direct PCR
The inserts were amplified using Quick Taq™ HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp).
Quick Taq™ HS DyeMix successfully and efficiently amplified all targets.
 |
M: 100 bp Ladder Markers Forward Primer: CGCCAGGTTTTCCCAGTCACGAC |
Contents/ PCR Set-up
Contents
- rTaq DNA Polymerase
- Anti-Taq antibody
- dNTP
- sElectrophoresis dye (BPB)
- Reaction buffer
TYPICAL PCR REACTION SETUP
| Component | Volume | Final Concentration |
|---|---|---|
| Quick Taq™ HS DyeMix | 25 µL | 1x |
| 10pmol /µL Primer #1 | 1.0 µL | 0.2 µM |
| 10pmol /µL Primer #2 | 1.0 µL | 0.2 µM |
| Template DNA | X µL | Genomic DNA ≤ 200 ng/50 µL Plasmid DNA ≤ 50 ng/50 µL Colony |
| PCR grade water | Y µL | |
| Total reaction volume | 50 µL |
Reference
- Lawyer, F. C. et al., Journal of Biological Chemistry, 264: 6427–6437 (1989) " High-level expression, purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5′→3′ exonuclease activity ' DOI: 10.1101/gr.2.4.275
- Kellogg, D. E. et al., BioTechniques, 16: 1134 (1994) "TaqStart Antibody: Hot Start PCR facilitated by a monoclonal antibody directed against Taq DNA polymerase"